Processing

Please wait...

Settings

Settings

Goto Application

Offices all Languages en Stemming true Single Family Member true

Save query

A private query is only visible to you when you are logged-in and can not be used in RSS feeds

Query Tree

Refine Options

Offices
All
Specify the language of your search keywords
Stemming reduces inflected words to their stem or root form.
For example the words fishing, fished,fish, and fisher are reduced to the root word,fish,
so a search for fisher returns all the different variations
Returns only one member of a family of patents

Full Query

IC:C12Q1/70

Side-by-side view shortcuts

General
Go to Search input
CTRL + SHIFT +
Go to Results (selected record)
CTRL + SHIFT +
Go to Detail (selected tab)
CTRL + SHIFT +
Go to Next page
CTRL +
Go to Previous page
CTRL +
Results (First, do 'Go to Results')
Go to Next record / image
/
Go to Previous record / image
/
Scroll Up
Page Up
Scroll Down
Page Down
Scroll to Top
CTRL + Home
Scroll to Bottom
CTRL + End
Detail (First, do 'Go to Detail')
Go to Next tab
Go to Previous tab

Analysis

1.WO/2020/139963UNIDIRECTIONAL PRESENTATION OF MEMBRANE PROTEINS IN NANOPARTICLE-SUPPORTED LIPOSOMES
WO 02.07.2020
Int.Class A61K 9/127
AHUMAN NECESSITIES
61MEDICAL OR VETERINARY SCIENCE; HYGIENE
KPREPARATIONS FOR MEDICAL, DENTAL, OR TOILET PURPOSES
9Medicinal preparations characterised by special physical form
10Dispersions; Emulsions
127Liposomes
Appl.No PCT/US2019/068601 Applicant PRESIDENT AND FELLOWS OF HARVARD COLLEGE Inventor CHOU, James
Presentation of membrane proteins to host immune systems has been a challenging problem due to complexity arising from the poor in vivo stability of the membrane-mimetic media often used for solubilizing the membrane proteins. The Inventors report the use of functionalized, biocompatible nanoparticles as substrates to guide the formation of proteoliposomes that can present many copies of membrane proteins in a unidirectional manner. The approach was demonstrated to present the membrane-proximal region of the HIV-1 envelope glycoprotein. These nanoparticle-supported liposomes are broadly applicable as membrane antigen vehicles for inducing host immune responses. In some instances, the technology supports generation of antibodies that do not generate an immunogenic response in comparison to conventional protein presentation (i.e., liposome).
2.WO/2020/139892METHODS AND MATERIALS FOR SINGLE CELL TRANSCRIPTOME-BASED DEVELOPMENT OF AAV VECTORS AND PROMOTERS
WO 02.07.2020
Int.Class C12N 15/864
CCHEMISTRY; METALLURGY
12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
15Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
09Recombinant DNA-technology
63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
79Vectors or expression systems specially adapted for eukaryotic hosts
85for animal cells
86Viral vectors
864Parvoviral vectors
Appl.No PCT/US2019/068489 Applicant UNIVERSITY OF PITTSBURGH - OF THE COMMONWEALTH SYSTEM OF HIGHER EDUCATION Inventor BYRNE, Leah
This document provides a high throughput method for the creation of AAV vectors and/or promoter sequences with high efficiency and/or specificity for multiple cell types.
3.WO/2020/132714METHOD FOR AMPLIFICATION OF NUCLEIC ACIDS
WO 02.07.2020
Int.Class C12Q 1/6865
CCHEMISTRY; METALLURGY
12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
1Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
68involving nucleic acids
6844Nucleic acid amplification reactions
6865Promoter-based amplification, e.g. nucleic acid sequence-based amplification , self-sustained sequence replication or transcription-based amplification system
Appl.No PCT/AU2019/051429 Applicant DEAKIN UNIVERSITY Inventor NAI, Yi Heng
The present disclosure relates to methods for amplification of nucleic acid sequences. In particular, the present disclosure relates to a nucleic acid sequence based amplification (NASBA) method for amplifying a target RNA sequence. The present disclosure also relates to NASBA kits and in vitro methods of diagnosing pathogen infections.
4.3674422SYSTEMS AND METHODS FOR DETECTING INFECTIOUS DISEASES
EP 01.07.2020
Int.Class C12Q 1/689
CCHEMISTRY; METALLURGY
12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
1Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
68involving nucleic acids
6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
6888for detection or identification of organisms
689for bacteria
Appl.No 19207298 Applicant THERANOS IP COMPANY LLC Inventor PATEL PRANAV
Systems, methods, and devices for detecting infections in a clinical sample are provided. Small-volume clinical samples obtained at a point-of-service (POS) location and may be tested at the POS location for multiple markers for multiple diseases, including upper and lower respiratory diseases. Samples may be tested for cytokines, or for inflammation indicators. Dilution of samples, or levels of detection, may be determined by the condition or past history of a subject. Test results may be obtained within a short amount of time after sample placement in a testing device, or within a short amount of time after being obtained from the subject. A prescription for treatment of a detected disorder may be provided, and may be filled, at the POS location. A bill may be automatically generated for the testing, or for the prescription, may be automatically sent to an insurance provider, and payment may be automatically obtained.
5.3674423COMPOSITIONS AND ASSAYS TO DETECT SEASONAL H3 INFLUENZA A VIRUS NUCLEIC ACID
EP 01.07.2020
Int.Class C12Q 1/70
CCHEMISTRY; METALLURGY
12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
1Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
70involving virus or bacteriophage
Appl.No 20154382 Applicant GEN PROBE INC Inventor TYLER EJAN
There is disclosed a composition for detecting the presence of seasonal H3 influenza virus A comprising at least two oligonucleotides specific for sequences that represent a H3 influenza virus A genome or transcripts made from the H3 influenza virus A genome, selected from the group consisting of: SEQ ID NO: 77 ACTAATGCTACTGAGCTGGT; SEQ ID NO: 78 CTTATTTTGGAAGCCATCACA; and SEQ ID NO: 79 ATCCTTGATGGAGAAAACTGCACACTA.
6.WO/2020/132090ASSAY FOR DETECTING HUMAN PAPILLOMA VIRUS (HPV)
WO 25.06.2020
Int.Class C12Q 1/6886
CCHEMISTRY; METALLURGY
12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
1Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
68involving nucleic acids
6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
6883for diseases caused by alterations of genetic material
6886for cancer
Appl.No PCT/US2019/067215 Applicant ABBOTT MOLECULAR INC. Inventor GRIMM, Wesley
The disclosure is directed to kits and methods for amplifying and detecting human papilloma virus (HPV) of genotype 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66, and/or 68 in a sample, which comprises a variety of combinations of forward oligonucleotide primers, reverse oligonucleotide primers, and oligonucleotide probes.
7.WO/2020/125295PRIMERS, PROBES, KIT AND DETECTION METHOD FOR DETECTING HUMAN IMMUNODEFICIENCY VIRUS NUCLEIC ACIDS
WO 25.06.2020
Int.Class C12Q 1/70
CCHEMISTRY; METALLURGY
12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
1Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
70involving virus or bacteriophage
Appl.No PCT/CN2019/119047 Applicant SUZHOU GENO-TRUTH BIOTECHNOLOGY CO. LTD. Inventor ZHANG, Huidan
Disclosed are primers, probes, a kit and a detection method for detecting human immunodeficiency virus nucleic acids. The primers for detecting human immunodeficiency virus nucleic acids comprise: a first primer pair, which comprises a first primer and a second primer, wherein the sequences of the first primer and the second primer are respectively as shown in SEQ ID NO.1 and SEQ ID NO.2; and a second primer pair, which comprises a third primer and a fourth primer, wherein the sequences of the third primer and the fourth primer are respectively as shown in SEQ ID NO.3 and SEQ ID NO.4. A probe pair comprises a first probe and a second probe, wherein the sequences of the first probe and the second probe are respectively as shown in SEQ ID NO.5 and SEQ ID NO.6. The kit comprises a primer group and the probe pair. The detection method comprises: performing, using the kit, PCR amplification on droplets formed by a PCR reaction solution, and on a detected human immunodeficiency virus nucleic acid sample coated with a droplet generation liquid.
8.WO/2020/125246PRIMERS, PROBE, KIT AND DETECTION METHOD FOR DETECTING HEPATITIS B VIRUS NUCLEIC ACID
WO 25.06.2020
Int.Class C12Q 1/70
CCHEMISTRY; METALLURGY
12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
1Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
70involving virus or bacteriophage
Appl.No PCT/CN2019/115837 Applicant SUZHOU GENO-TRUTH BIOTECHNOLOGY CO. LTD. Inventor ZHANG, Huidan
Provided are primers, a probe, a kit and a detection method for detecting hepatitis B virus nucleic acid. A primer pair for detecting hepatitis B virus nucleic acid comprises: a first primer and a second primer, the sequences thereof being shown in SEQ ID NO.1 and SEQ ID NO.2, respectively. The sequence of the probe is shown in SEQ ID NO.3. The kit comprises the described primer pair and probe. The detection method for hepatitis B virus nucleic acid comprises: using a sample processing device to mix a nucleic acid sample to be detected with a PCR reaction solution, and wrapping the formed mixed solution by using a droplet generation solution to form droplets containing a single nucleic acid or not containing nucleic acid; and using the kit to perform PCR amplification on the droplets, and detecting the PCR amplification product. The kit has a low detection limit, high sensitivity and good specificity. The detection method is simple and fast, has high detection efficiency and is low-cost.
9.3670674COMPOSITIONS AND METHODS FOR DETECTING HUMAN PAPILLOMAVIRUS NUCLEIC ACID
EP 24.06.2020
Int.Class C12Q 1/70
CCHEMISTRY; METALLURGY
12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
1Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
70involving virus or bacteriophage
Appl.No 20151189 Applicant GEN PROBE INC Inventor SCHRODER M ASTRID RW
There is disclosed an oligomer combination for detecting a human papillomavirus (HPV) target nucleic acid in a sample suspected of containing HPV type 31 (HPV31) or HPV type 33 (HPV33) and at least one of HPV types 52 and 58, said oligomer combination comprising: (i) first and second amplification oligomers for specifically amplifying an HPV33 nucleic acid target region, wherein the first HPV33 amplification oligomer comprises a first target-hybridizing sequence that is from about 15 to about 27 contiguous nucleotides contained in the sequence of SEQ ID NO:66 and that includes at least the sequence of SEQ ID NO:67, SEQ ID NO:68, or SEQ ID NO:69; and the second HPV33 amplification oligomer comprises a second target-hybridizing sequence that is from about 15 to about 27 contiguous nucleotides contained in the sequence of SEQ ID NO:70 and that includes at least the sequence of SEQ ID NO:71, SEQ ID NO:72, or SEQ ID NO:73; and (ii) first and second amplification oligomers for specifically amplifying an HPV31 nucleic acid target region, wherein the first HPV31 amplification oligomer comprises a first target-hybridizing sequence that is from about 15 to about 27 contiguous nucleotides contained in the sequence of SEQ ID NO:74 and that includes at least the sequence of SEQ ID NO:75, SEQ ID NO:76, or SEQ ID NO:77; and the second HPV31 amplification oligomer comprises a second target-hybridizing sequence that is from about 15 to about 30 contiguous nucleotides contained in the sequence of SEQ ID NO:78 and that includes at least the sequence of SEQ ID NO:79, SEQ ID NO:80, or SEQ ID NO:81.
10.10689716Materials and methods for detecting coronavirus
US 23.06.2020
Int.Class C12Q 1/68
CCHEMISTRY; METALLURGY
12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
1Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
68involving nucleic acids
Appl.No 16823522 Applicant UNIVERSITY OF MIAMI Inventor Sylvia Daunert

The disclosure relates to test kits and methods for detecting the presence of Coronavirus polynucleotides in a biological sample.